Mature sequence pbv-let-7c-2-3p

Accession numberMIMAT0038800
IDpbv-let-7c-2-3p
Stem-Loop pbv-let-7c-2
Sequence
cuauacagccuccuagcuuucc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).