Mature sequence ami-miR-27b-3p

Accession numberMIMAT0038070
IDami-miR-27b-3p
Stem-Loop ami-mir-27b
Sequence
uucacaguggcuaaguucug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).