Mature sequence cpi-miR-124-3p

Accession numberMIMAT0037727
IDcpi-miR-124-3p
Stem-Loop cpi-mir-124-1 cpi-mir-124-2 cpi-mir-124-3 cpi-mir-124-4
Sequence
uaaggcacgcggugaaugcca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).