Mature sequence gma-miR398b-5p

Accession numberMIMAT0037314
IDgma-miR398b-5p
Stem-Loop gma-MIR398b
Sequence
gaguggaucugagaacacaagg
Get sequence
Deep sequencing reads, experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2