Mature sequence ssc-miR-378b-3p

Accession numberMIMAT0037082
IDssc-miR-378b-3p
Stem-Loop ssc-mir-378b
Sequence
acuggacuuggagucagaagu
Get sequence
Deep sequencing275 reads, 14 experiments

References

1
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).