Mature sequence tae-miR9774

Accession numberMIMAT0036985
IDtae-miR9774
Stem-Loop tae-MIR9774
Sequence
caagauauuggguauuucuguc
Get sequence
Deep sequencing41128 reads, 116 experiments

References

1
PMID:19499258 "Novel microRNAs uncovered by deep sequencing of small RNA transcriptomes in bread wheat (Triticum aestivum L.) and Brachypodium distachyon (L.) Beauv" Wei B, Cai T, Zhang R, Li A, Huo N, Li S, Gu YQ, Vogel J, Jia J, Qi Y, Mao L Funct Integr Genomics. 9:499-511(2009).