Mature sequence gma-miR9761

Accession numberMIMAT0036397
IDgma-miR9761
Stem-Loop gma-MIR9761
Sequence
ugaaggucuaggauauuuugu
Get sequence
Deep sequencing reads, experiments

References

1