Mature sequence gma-miR5670b

Accession numberMIMAT0036393
IDgma-miR5670b
Stem-Loop gma-MIR5670b
Sequence
cacaucauaccauauuugcuuc
Get sequence
Deep sequencing reads, experiments

References

1