Mature sequence gma-miR9739

Accession numberMIMAT0036359
IDgma-miR9739
Stem-Loop gma-MIR9739
Sequence
uuugaauguccagauacguac
Get sequence
Deep sequencing reads, experiments

References

1