Mature sequence gma-miR9734

Accession numberMIMAT0036354
IDgma-miR9734
Stem-Loop gma-MIR9734
Sequence
ucgugaaugagauuuguguugcuu
Get sequence
Deep sequencing reads, experiments

References

1