Mature sequence gma-miR5671b

Accession numberMIMAT0036348
IDgma-miR5671b
Stem-Loop gma-MIR5671b
Sequence
uacccgaauuugcuuccaugau
Get sequence
Deep sequencing reads, experiments

References

1