Mature sequence chi-miR-30a-5p

Accession numberMIMAT0036121
IDchi-miR-30a-5p
Stem-Loop chi-mir-30a
Sequence
uguaaacauccucgacuggaagcu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).