Mature sequence chi-miR-211

Accession numberMIMAT0036057
IDchi-miR-211
Stem-Loop chi-mir-211
Sequence
uucccuuugucauccuuugccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).