Mature sequence chi-miR-183

Accession numberMIMAT0036007
IDchi-miR-183
Stem-Loop chi-mir-183
Sequence
uauggcacugguagaauucacu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23981187 "Identification of conservative microRNAs in Saanen dairy goat testis through deep sequencing" Wu J, Zhu H, Song W, Li M, Liu C, Li N, Tang F, Mu H, Liao M, Li X, Guan W, Li X, Hua J Reprod Domest Anim. 49:32-40(2014).