Mature sequence tae-miR5048-5p

Accession numberMIMAT0035803
IDtae-miR5048-5p
Stem-Loop tae-MIR5048
Sequence
uuugcagguuuuaggucuaagu
Get sequence
Deep sequencing7147086 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).