Mature sequence tae-miR167c-5p

Accession numberMIMAT0035789
IDtae-miR167c-5p
Stem-Loop tae-MIR167c
Sequence
ugaagcugccagcaugaucugc
Get sequence
Deep sequencing1299649 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).