Mature sequence tae-miR9670-3p

Accession numberMIMAT0035785
IDtae-miR9670-3p
Stem-Loop tae-MIR9670
Sequence
agguggaauacuugaagaaga
Get sequence
Deep sequencing7240 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).