Mature sequence tae-miR9666a-3p

Accession numberMIMAT0035778
IDtae-miR9666a-3p
Stem-Loop tae-MIR9666a
Sequence
cgguagggcuguaugauggcga
Get sequence
Deep sequencing118660 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).