Mature sequence tae-miR9663-5p

Accession numberMIMAT0035773
IDtae-miR9663-5p
Stem-Loop tae-MIR9663
Sequence
aagcguagucgaacgaaucug
Get sequence
Deep sequencing544158 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).