Mature sequence tae-miR9653a-3p

Accession numberMIMAT0035760
IDtae-miR9653a-3p
Stem-Loop tae-MIR9653a
Sequence
uuugagacuuuggccauggcc
Get sequence
Deep sequencing484 reads, 103 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).