Mature sequence rno-miR-148a-5p

Accession numberMIMAT0035724
IDrno-miR-148a-5p
Stem-Loop rno-mir-148a
Sequence
aaaguucugagacacucugacuc
Get sequence
Deep sequencing671852 reads, 500 experiments
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).