Mature sequence bdi-miR9490

Accession numberMIMAT0035498
IDbdi-miR9490
Stem-Loop bdi-MIR9490
Sequence
aggccacacccuaauggucgugcg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24367943 "Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon" Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ Genome Biol. 14:R145(2013).