Mature sequence sly-miR156e-3p

Accession numberMIMAT0035454
IDsly-miR156e-3p
Stem-Loop sly-MIR156e
Sequence
gcuuacucucuaucugucacc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).