Mature sequence pmi-miR-2009-3p

Accession numberMIMAT0032183
IDpmi-miR-2009-3p
Stem-Loop pmi-mir-2009
Sequence
ugaguugucccacaaagaacac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23703796 "MicroRNAs support the monophyly of enteropneust hemichordates" Peterson KJ, Su YH, Arnone MI, Swalla B, King BL J Exp Zool B Mol Dev Evol. 320:368-374(2013).