Mature sequence ath-miR3932b-5p

Accession numberMIMAT0032113
IDath-miR3932b-5p
Stem-Loop ath-MIR3932b
Sequence
uuugacgugcucgaucugcuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20621980 "siRNAs from miRNA sites mediate DNA methylation of target genes" Chellappan P, Xia J, Zhou X, Gao S, Zhang X, Coutino G, Vazquez F, Zhang W, Jin H Nucleic Acids Res. 38:6883-6894(2010).