Mature sequence cel-miR-1829b-3p

Accession numberMIMAT0032037
IDcel-miR-1829b-3p
Stem-Loop cel-mir-1829b
Sequence
caaccacuggaauuucucuauu
Get sequence
Deep sequencing740 reads, 17 experiments
Database links
QuickGO function

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
3
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).