Mature sequence dme-miR-1008-5p

Accession numberMIMAT0032028
IDdme-miR-1008-5p
Stem-Loop dme-mir-1008
Sequence
guaaauaucuaaaguugaacu
Get sequence
Deep sequencing456 reads, 36 experiments
Database links
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).