Mature sequence dme-miR-1004-5p

Accession numberMIMAT0032027
IDdme-miR-1004-5p
Stem-Loop dme-mir-1004
Sequence
guugggggacauugaucucggag
Get sequence
Deep sequencing4168 reads, 33 experiments
Database links
QuickGO function

References

1
PMID:17589500 "Intronic microRNA precursors that bypass Drosha processing" Ruby JG, Jan CH, Bartel DP Nature. 448:83-86(2007).