Mature sequence cel-miR-789-5p

Accession numberMIMAT0032016
IDcel-miR-789-5p
Stem-Loop cel-mir-789-1
Sequence
aauugaugacccagacaaggac
Get sequence
Deep sequencing697 reads, 13 experiments
Database links
QuickGO function

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2