Mature sequence dre-miR-181a-2-3p

Accession numberMIMAT0032007
IDdre-miR-181a-2-3p
Stem-Loop dre-mir-181a-2
Sequence
accaucgaccguugacuguacc
Get sequence
Deep sequencing22744 reads, 11 experiments
Database links
QuickGO function

References