Mature sequence hsa-miR-7974

Accession numberMIMAT0031177
IDhsa-miR-7974
Stem-Loop hsa-mir-7974
Sequence
aggcugugaugcucuccugagccc
Get sequence
Deep sequencing3487 reads, 56 experiments
Predicted targets

References

1
PMID:23660593 "Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes" Velthut-Meikas A, Simm J, Tuuri T, Tapanainen JS, Metsis M, Salumets A Mol Endocrinol. 27:1128-1141(2013).