Mature sequence hsa-miR-8080

• Accession number: MIMAT0031007
• ID: hsa-miR-8080
• Stem-Loop: hsa-mir-8080
• Sequence: gaaggacacuggugucaacggcu
• Deep sequencing: 1 reads, 1 experiments
• Predicted targets:
  • TargetScanVert:hsa-miR-8080
  • miRDB:hsa-miR-8080

References

1. PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).