Mature sequence rno-miR-155-3p

• Accession number: MIMAT0030410
• ID: rno-miR-155-3p
• Stem-Loop: rno-mir-155
• Sequence: cuccuaccuguuagcauuaac
• Deep sequencing: 90 reads, 66 experiments
• Predicted targets:
  • TargetScanVert:rno-miR-155-3p
  • miRDB:rno-miR-155-3p

References

1. PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).