Mature sequence ptc-miR6459b

Accession numberMIMAT0030396
IDptc-miR6459b
Stem-Loop ptc-MIR6459b
Sequence
ucucaagcccaaauucgauc
Get sequence
Deep sequencing reads, experiments

References

1