Mature sequence osa-miR1437b-3p

Accession numberMIMAT0029954
IDosa-miR1437b-3p
Stem-Loop osa-MIR1437b
Sequence
gugcuggcgagcuccggugccgca
Get sequence
Deep sequencing3 reads, 2 experiments

References

1