Mature sequence osa-miR1437b-5p

Accession numberMIMAT0029953
IDosa-miR1437b-5p
Stem-Loop osa-MIR1437b
Sequence
gggaggaaacagugccuagug
Get sequence
Deep sequencing4 reads, 2 experiments

References

1