Mature sequence mmu-miR-7658-3p

Accession numberMIMAT0029823
IDmmu-miR-7658-3p
Stem-Loop mmu-mir-7658
Sequence
accaccuuccucacccacgcu
Get sequence
Deep sequencing42 reads, 20 experiments
Predicted targets

References

1