Mature sequence mmu-miR-7658-5p

Accession numberMIMAT0029822
IDmmu-miR-7658-5p
Stem-Loop mmu-mir-7658
Sequence
ugugggcguggcggugcugg
Get sequence
Deep sequencing171 reads, 30 experiments
Predicted targets

References

1