Mature sequence cbr-miR-2

Accession numberMIMAT0029606
IDcbr-miR-2
Stem-Loop cbr-mir-2
Sequence
uaucacagccagcuuugaugugc
Get sequence
Deep sequencing reads, experiments

References

1