Mature sequence lja-miR172a

Accession numberMIMAT0029319
IDlja-miR172a
Stem-Loop lja-MIR172a
Sequence
agaaucuugaugaugcugcag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:23071252 "Two microRNAs linked to nodule infection and nitrogen-fixing ability in the legume Lotus japonicus" De Luis A, Markmann K, Cognat V, Holt DB, Charpentier M, Parniske M, Stougaard J, Voinnet O Plant Physiol. 160:2137-2154(2012).