Mature sequence mmu-miR-7071-5p

Accession numberMIMAT0028048
IDmmu-miR-7071-5p
Stem-Loop mmu-mir-7071
Sequence
cccgggagcgaggugcugcagcg
Get sequence
Deep sequencing18 reads, 15 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).