Mature sequence hsa-miR-6770-5p

Accession numberMIMAT0027440
IDhsa-miR-6770-5p
Stem-Loop hsa-mir-6770-1 hsa-mir-6770-2 hsa-mir-6770-3
Sequence
ugagaaggcacagcuugcacguga
Get sequence
Deep sequencing720 reads, 71 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).