Mature sequence ppe-miR482e

Accession numberMIMAT0027318
IDppe-miR482e
Stem-Loop ppe-MIR482e
Sequence
uugccuauuccucccaugccaa
Get sequence
Deep sequencing reads, experiments

References

1