Mature sequence mtr-miR482-3p

Accession numberMIMAT0027102
IDmtr-miR482-3p
Stem-Loop mtr-MIR482
Sequence
cuuaccuacaccucccaugcc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21571671 "Stars and symbiosis: microRNA- and microRNA*-mediated transcript cleavage involved in arbuscular mycorrhizal symbiosis" Devers EA, Branscheid A, May P, Krajinski F Plant Physiol. 156:1990-2010(2011).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).