Mature sequence mtr-miR2592b-5p

Accession numberMIMAT0026924
IDmtr-miR2592b-5p
Stem-Loop mtr-MIR2592b
Sequence
acaacaggacucaagcauuuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).