Mature sequence hsa-miR-128-1-5p

Accession numberMIMAT0026477
IDhsa-miR-128-1-5p
Stem-Loop hsa-mir-128-1
Sequence
cggggccguagcacugucugaga
Get sequence
Deep sequencing688 reads, 94 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).