Accession | MIMAT0026475 |
Description | hsa-miR-210-5p mature miRNA |
Hairpins | |
Sequence | AGCCCCUGCCCACCGCACACUG |
Evidence |
experimental
Illumina [5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0030514 negative regulation of BMP signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:29944867 | has_input UniProtKB:P12643 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29944867 | has_input UniProtKB:P12643 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28397307 | has_input UniProtKB:P00751 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29944867 | has_input UniProtKB:P12643 |
involved_in | GO:0001818 negative regulation of cytokine production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:29944867 | has_input UniProtKB:P12643 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28397307 | has_input UniProtKB:P00751 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29944867 | has_input UniProtKB:P12643 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|