Mature sequence sbi-miR5568g-3p

Accession numberMIMAT0026466
IDsbi-miR5568g-3p
Stem-Loop sbi-MIR5568g
Sequence
aaaacgucuuauaauuuggag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22747909 "Computational identification and analysis of novel sugarcane microRNAs" Thiebaut F, Grativol C, Carnavale-Bottino M, Rojas CA, Tanurdzic M, Farinelli L, Martienssen RA, Hemerly AS, Ferreira PC BMC Genomics. 13:290(2012).