Mature sequence ccr-miR-203a

Accession numberMIMAT0026260
IDccr-miR-203a
Stem-Loop ccr-mir-203a
Sequence
gugaaauguuuaggaccacuug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22303472 "Identification and profiling of microRNAs from skeletal muscle of the common carp" Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB PLoS One. 7:e30925(2012).