Mature sequence mdm-miR156k

Accession numberMIMAT0025877
IDmdm-miR156k
Stem-Loop mdm-MIR156k
Sequence
ugacagaagagagugagcac
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).